Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter 

2020 / Nucleic Acids Research

Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex… Continue reading Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter 

Heather Haffner

Effect of the fluorination degree of partially fluorinated octyl-phosphocholine surfactants on their interfacial properties and interactions with purple membrane as a membrane protein model

2020 / Chemistry and Physics of Lipids

Interfacial properties and membrane protein solubilization activity of a series of partially fluorinated octyl-phosphocholine (PC) surfactants were investigated from the… Continue reading Effect of the fluorination degree of partially fluorinated octyl-phosphocholine surfactants on their interfacial properties and interactions with purple membrane as a membrane protein model

Heather Haffner

Structural Changes and Antibacterial Activity of Epsilon-poly-l-lysine in Response to pH and Phase Transition and Their Mechanisms

2020 / Journal of Agriculture and Food Chemistry

ε-Poly-l-lysine (ε-PL) consists of 25–35 lysine residues which are linked by an isopeptide bond formed by dehydration condensation of α-carboxyl… Continue reading Structural Changes and Antibacterial Activity of Epsilon-poly-l-lysine in Response to pH and Phase Transition and Their Mechanisms

Heather Haffner

Elucidation of binding mechanism of dibutyl phthalate on bovine serum albumin by spectroscopic analysis and molecular docking method

2020 / Spectrochimica Acta Part A: Molecular and Biomolecular Spectroscopy

Dibutyl phthalate has been illegally used in beverages and directly affects the human health. Herein, the interaction occurred between dibutyl… Continue reading Elucidation of binding mechanism of dibutyl phthalate on bovine serum albumin by spectroscopic analysis and molecular docking method

Heather Haffner

Bioaffinity Fishing Procedure Using Secretory Phospholipase A2 for Screening for Bioactive Components: Modulation of Pharmacological Effect Induced by sPLA2 from Crotalus durissus terrificus by Hispidulin from Moquiniastrum floribundum

2020 / molecules

Bioaffinity capturing of molecules allows the discovery of bioactive compounds and decreases the need for various stages in the natural… Continue reading Bioaffinity Fishing Procedure Using Secretory Phospholipase A2 for Screening for Bioactive Components: Modulation of Pharmacological Effect Induced by sPLA2 from Crotalus durissus terrificus by Hispidulin from Moquiniastrum floribundum

Heather Haffner

Developing an injectable co-formulation of two antidiabetic drugs: Excipient impact on peptide aggregation and pharmacokinetic properties

2020 / International Journal of Pharmaceutics

Combination therapy in Type 2 Diabetes Mellitus is necessary to achieve tight glycaemic control and reduce complication risk. Current treatment… Continue reading Developing an injectable co-formulation of two antidiabetic drugs: Excipient impact on peptide aggregation and pharmacokinetic properties

Heather Haffner

Preferential Recognition and Extraction to Pentoses over Hexoses by a D6h-Symmetrical Ethynylphenol Macrocycle with Six Inner Phenolic Hydroxy Groups

2020 / Journal of Organic Chemistry

A macrocycle consisting of six ethynylphenol units was developed as a host architecture for saccharides. The rigid framework of the… Continue reading Preferential Recognition and Extraction to Pentoses over Hexoses by a D6h-Symmetrical Ethynylphenol Macrocycle with Six Inner Phenolic Hydroxy Groups

Heather Haffner