Chiral 1,1’-binaphthyl-linked diporphyrin ‘tweezers’ (R)-1/(S)-1 and the corresponding zinc(II) complexes (R)-2/(S)-2 were prepared as chiral host molecules, and their utility for chiral… Continue reading Diporphyrin tweezer for multichannel spectroscopic analysis of enantiomeric excess
Heather Haffner
March 24, 2020
Six new compounds including two azaphilones, lunatoic acids D–E (1, 2), three isocoumarins, lunatinins B–D (3-5), and one α-pyrone derivative, lunatinin… Continue reading New azaphilone, isocoumarin and α-pyrone derivatives from the marine-derived gut fungus Paraphaeosphaeria sp. XZD2-1
Heather Haffner
March 24, 2020
Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex… Continue reading Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter
Heather Haffner
March 24, 2020
The UvrB subunit is a central component of the UvrABC incision complex and plays a pivotal role in damage recognition,… Continue reading Deciphering the essentiality and function of SxSx motif in Mycobacterium tuberculosis UvrB
Heather Haffner
March 24, 2020
Heather Haffner
March 24, 2020
Supramolecular peptide materials have attracted increasing attention due to their natural biological origin and versatile applications. However, it is often… Continue reading Injectable self-assembled bola-dipeptide hydrogels for sustained photodynamic prodrug delivery and enhanced tumor therapy
Heather Haffner
March 24, 2020
Heather Haffner
March 24, 2020
Guanine-rich DNA sequences can spontaneously fold into four-stranded structures called G-quadruplexes (G4s). G4s have been identified extensively in the promoter… Continue reading Chiral Ru(ii) complexes act as a potential non-viral gene carrier for directional transportation to the nucleus and cytoplasm
Heather Haffner
March 24, 2020
Heather Haffner
March 24, 2020
Seven previously undescribed compounds, including five coumarins, (+/−)-murpanitin A and murpanitins B-D, and a pair of spirocyclopentenone enantiomers, (+/−)-murrayaspiroketone, along… Continue reading Coumarin and spirocyclopentenone derivatives from the leaves and stems of Murraya paniculata (L.) Jack
Heather Haffner
March 24, 2020
Gentimilegenins A, B (1, 2), (6R, 8R)-6-hydroxy swerimuslactone A (3), (6R, 8S)-6-hydroxy swerimuslactone A (4), 4-hydroxy roburic acid methyl ester (5), (±) 3′-hydroxy… Continue reading Seven new chemical constituents from the roots of Gentiana macrophylla pall
Heather Haffner
March 24, 2020
TRPV1 is a ligand-gated ion channel and plays an important role in detecting noxious heat and pain with an unknown… Continue reading Synthesis and biological activity study of the retro-isomer of RhTx against TRPV1
Heather Haffner
March 24, 2020
Heather Haffner
March 24, 2020
The eye lens is mainly composed of crystallins, which undergo modifications such as oxidation, deamidation and isomerization with aging. Asp58,… Continue reading A single Asp isomer substitution in an αA-crystallin-derived peptide induces a large change in peptide properties
Heather Haffner
March 24, 2020
Utilization of safe cytotoxic agents with precise anticancer activity is considered as the prime focus of cancer therapeutics research. A… Continue reading Pluronic Polymer-Based Ormeloxifene Nanoformulations Induce Superior Anticancer Effects in Pancreatic Cancer Cells
Heather Haffner
March 24, 2020
Different protein conformations may be involved in the development of clinical manifestations associated with human amyloidosis. Although a fibrillar conformation… Continue reading Fibrillar conformation of an apolipoprotein A-I variant involved in amyloidosis and atherosclerosis
Heather Haffner
March 24, 2020
Heather Haffner
March 24, 2020
Heather Haffner
March 24, 2020
It is hypothesized that the Ca2+ ions were involved in the activity, folding and stabilization of many protein structures. Many of… Continue reading Calcium-Induced Activity and Folding of a Repeat in Toxin Lipase from Antarctic Pseudomonas fluorescens Strain AMS8
Heather Haffner
March 24, 2020
Heather Haffner
March 24, 2020