Found 9617 Results / Page 114 of 481
2020 / Journal of Natural Medicines
Three new benzylisoquinoline alkaloids, (1′S)-12′-hydroxyl-linderegatine (1), (1S)-5′-O-p-hydroxybenzoyl norreticuline (2), (1R, 1′R)-11,11′-biscoclaurine (3), along with 18 known compounds were isolated from… Continue reading Chemical constituents from the roots of Lindera aggregata and their biological activities
2020 / International Journal of Biological Macromolecules
Sphingosine kinase 1 (SphK1) is a lipid kinase which plays vital role in the regulation of varieties of biological processes… Continue reading Investigation of guanidinium chloride-induced unfolding pathway of sphingosine kinase 1
2020 / Frontiers of Chemical Science and Engineering
Chiral 1,1’-binaphthyl-linked diporphyrin ‘tweezers’ (R)-1/(S)-1 and the corresponding zinc(II) complexes (R)-2/(S)-2 were prepared as chiral host molecules, and their utility for chiral… Continue reading Diporphyrin tweezer for multichannel spectroscopic analysis of enantiomeric excess
2020 / Phytochemistry Letters
Six new compounds including two azaphilones, lunatoic acids D–E (1, 2), three isocoumarins, lunatinins B–D (3-5), and one α-pyrone derivative, lunatinin… Continue reading New azaphilone, isocoumarin and α-pyrone derivatives from the marine-derived gut fungus Paraphaeosphaeria sp. XZD2-1
2020 / Nucleic Acids Research
Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex… Continue reading Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter
2020 / Biochimie
The UvrB subunit is a central component of the UvrABC incision complex and plays a pivotal role in damage recognition,… Continue reading Deciphering the essentiality and function of SxSx motif in Mycobacterium tuberculosis UvrB
2020 / Chemistry and Physics of Lipids
Interfacial properties and membrane protein solubilization activity of a series of partially fluorinated octyl-phosphocholine (PC) surfactants were investigated from the… Continue reading Effect of the fluorination degree of partially fluorinated octyl-phosphocholine surfactants on their interfacial properties and interactions with purple membrane as a membrane protein model
2020 / Journal of Controlled Release
Supramolecular peptide materials have attracted increasing attention due to their natural biological origin and versatile applications. However, it is often… Continue reading Injectable self-assembled bola-dipeptide hydrogels for sustained photodynamic prodrug delivery and enhanced tumor therapy
2020 / Journal of Agriculture and Food Chemistry
ε-Poly-l-lysine (ε-PL) consists of 25–35 lysine residues which are linked by an isopeptide bond formed by dehydration condensation of α-carboxyl… Continue reading Structural Changes and Antibacterial Activity of Epsilon-poly-l-lysine in Response to pH and Phase Transition and Their Mechanisms
2020 / Metallomics
Guanine-rich DNA sequences can spontaneously fold into four-stranded structures called G-quadruplexes (G4s). G4s have been identified extensively in the promoter… Continue reading Chiral Ru(ii) complexes act as a potential non-viral gene carrier for directional transportation to the nucleus and cytoplasm
2020 / Spectrochimica Acta Part A: Molecular and Biomolecular Spectroscopy
Dibutyl phthalate has been illegally used in beverages and directly affects the human health. Herein, the interaction occurred between dibutyl… Continue reading Elucidation of binding mechanism of dibutyl phthalate on bovine serum albumin by spectroscopic analysis and molecular docking method
2020 / Colloids and Surfaces A
The aim of the study was to immobilize zinc ions by β-lactoglobulin (βLG) micelles. The investigation focused on physicochemical properties… Continue reading A study of zinc ions immobilization by β-lactoglobulin
2020 / Phytochemistry
Seven previously undescribed compounds, including five coumarins, (+/−)-murpanitin A and murpanitins B-D, and a pair of spirocyclopentenone enantiomers, (+/−)-murrayaspiroketone, along… Continue reading Coumarin and spirocyclopentenone derivatives from the leaves and stems of Murraya paniculata (L.) Jack
2020 / Fitoterpia
Gentimilegenins A, B (1, 2), (6R, 8R)-6-hydroxy swerimuslactone A (3), (6R, 8S)-6-hydroxy swerimuslactone A (4), 4-hydroxy roburic acid methyl ester (5), (±) 3′-hydroxy… Continue reading Seven new chemical constituents from the roots of Gentiana macrophylla pall
2020
TRPV1 is a ligand-gated ion channel and plays an important role in detecting noxious heat and pain with an unknown… Continue reading Synthesis and biological activity study of the retro-isomer of RhTx against TRPV1
2020 / molecules
Bioaffinity capturing of molecules allows the discovery of bioactive compounds and decreases the need for various stages in the natural… Continue reading Bioaffinity Fishing Procedure Using Secretory Phospholipase A2 for Screening for Bioactive Components: Modulation of Pharmacological Effect Induced by sPLA2 from Crotalus durissus terrificus by Hispidulin from Moquiniastrum floribundum
2020 / Experimental Eye Research
The eye lens is mainly composed of crystallins, which undergo modifications such as oxidation, deamidation and isomerization with aging. Asp58,… Continue reading A single Asp isomer substitution in an αA-crystallin-derived peptide induces a large change in peptide properties
2020 / ACS Omega
Utilization of safe cytotoxic agents with precise anticancer activity is considered as the prime focus of cancer therapeutics research. A… Continue reading Pluronic Polymer-Based Ormeloxifene Nanoformulations Induce Superior Anticancer Effects in Pancreatic Cancer Cells
2020 / Food Chemistry
Formation of protein gels in processed muscle foods is one of the most important functionalities. To explore the mechanisms responsible… Continue reading Site-specific incorporation of sodium tripolyphosphate into myofibrillar protein from mantis shrimp (Oratosquilla oratoria) promotes protein crosslinking and gel network formation
2020 / Free Radical Biology and Medicine
Cysteine sulfinic acid (Cys-SO2–) is a non-enzymatic oxidative post-translational modification (PTM) that has been identified in hundreds of proteins. However,… Continue reading Structural preferences of cysteine sulfinic acid: The sulfinate engages in multiple local interactions with the peptide backbone
