Three new benzylisoquinoline alkaloids, (1′S)-12′-hydroxyl-linderegatine (1), (1S)-5′-O-p-hydroxybenzoyl norreticuline (2), (1R, 1′R)-11,11′-biscoclaurine (3), along with 18 known compounds were isolated from… Continue reading Chemical constituents from the roots of Lindera aggregata and their biological activities
Leah Pandiscia, PhD
March 24, 2020
Sphingosine kinase 1 (SphK1) is a lipid kinase which plays vital role in the regulation of varieties of biological processes… Continue reading Investigation of guanidinium chloride-induced unfolding pathway of sphingosine kinase 1
Leah Pandiscia, PhD
March 24, 2020
Chiral 1,1’-binaphthyl-linked diporphyrin ‘tweezers’ (R)-1/(S)-1 and the corresponding zinc(II) complexes (R)-2/(S)-2 were prepared as chiral host molecules, and their utility for chiral… Continue reading Diporphyrin tweezer for multichannel spectroscopic analysis of enantiomeric excess
Leah Pandiscia, PhD
March 24, 2020
Six new compounds including two azaphilones, lunatoic acids D–E (1, 2), three isocoumarins, lunatinins B–D (3-5), and one α-pyrone derivative, lunatinin… Continue reading New azaphilone, isocoumarin and α-pyrone derivatives from the marine-derived gut fungus Paraphaeosphaeria sp. XZD2-1
Leah Pandiscia, PhD
March 24, 2020
Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex… Continue reading Cytosine epigenetic modification modulates the formation of an unprecedented G4 structure in the WNT1 promoter
Leah Pandiscia, PhD
March 24, 2020
The UvrB subunit is a central component of the UvrABC incision complex and plays a pivotal role in damage recognition,… Continue reading Deciphering the essentiality and function of SxSx motif in Mycobacterium tuberculosis UvrB
Leah Pandiscia, PhD
March 24, 2020
Leah Pandiscia, PhD
March 24, 2020
Supramolecular peptide materials have attracted increasing attention due to their natural biological origin and versatile applications. However, it is often… Continue reading Injectable self-assembled bola-dipeptide hydrogels for sustained photodynamic prodrug delivery and enhanced tumor therapy
Leah Pandiscia, PhD
March 24, 2020
Leah Pandiscia, PhD
March 24, 2020
Guanine-rich DNA sequences can spontaneously fold into four-stranded structures called G-quadruplexes (G4s). G4s have been identified extensively in the promoter… Continue reading Chiral Ru(ii) complexes act as a potential non-viral gene carrier for directional transportation to the nucleus and cytoplasm
Leah Pandiscia, PhD
March 24, 2020
Leah Pandiscia, PhD
March 24, 2020
The aim of the study was to immobilize zinc ions by β-lactoglobulin (βLG) micelles. The investigation focused on physicochemical properties… Continue reading A study of zinc ions immobilization by β-lactoglobulin
Leah Pandiscia, PhD
March 24, 2020
Seven previously undescribed compounds, including five coumarins, (+/−)-murpanitin A and murpanitins B-D, and a pair of spirocyclopentenone enantiomers, (+/−)-murrayaspiroketone, along… Continue reading Coumarin and spirocyclopentenone derivatives from the leaves and stems of Murraya paniculata (L.) Jack
Leah Pandiscia, PhD
March 24, 2020
Gentimilegenins A, B (1, 2), (6R, 8R)-6-hydroxy swerimuslactone A (3), (6R, 8S)-6-hydroxy swerimuslactone A (4), 4-hydroxy roburic acid methyl ester (5), (±) 3′-hydroxy… Continue reading Seven new chemical constituents from the roots of Gentiana macrophylla pall
Leah Pandiscia, PhD
March 24, 2020
TRPV1 is a ligand-gated ion channel and plays an important role in detecting noxious heat and pain with an unknown… Continue reading Synthesis and biological activity study of the retro-isomer of RhTx against TRPV1
Leah Pandiscia, PhD
March 24, 2020
Leah Pandiscia, PhD
March 24, 2020
The eye lens is mainly composed of crystallins, which undergo modifications such as oxidation, deamidation and isomerization with aging. Asp58,… Continue reading A single Asp isomer substitution in an αA-crystallin-derived peptide induces a large change in peptide properties
Leah Pandiscia, PhD
March 24, 2020
Utilization of safe cytotoxic agents with precise anticancer activity is considered as the prime focus of cancer therapeutics research. A… Continue reading Pluronic Polymer-Based Ormeloxifene Nanoformulations Induce Superior Anticancer Effects in Pancreatic Cancer Cells
Leah Pandiscia, PhD
March 24, 2020
Leah Pandiscia, PhD
March 24, 2020
Cysteine sulfinic acid (Cys-SO2–) is a non-enzymatic oxidative post-translational modification (PTM) that has been identified in hundreds of proteins. However,… Continue reading Structural preferences of cysteine sulfinic acid: The sulfinate engages in multiple local interactions with the peptide backbone
Leah Pandiscia, PhD
March 24, 2020